Travertine stone (Abbas Abad type) is one of the widely used stones in Iran. The mines of this stone, one of the most luxurious travertine stones in the world with a white-background color, are located in Mahalat, although its production is mainly carried out in Isfahan province. In our visits of various building stone sites in Hafiz town, Shiraz, Fars province in 2021, loose and rotten stones with black streaks were observed from which the rocks are cracked, causing a severe damage to stonework’s industry (Fig. 1a). To isolate fungi, small pieces (5 × 5 mm) of stone samples were surface disinfested with 0.5% sodium hypochlorite for 1 min, washed three times with sterilized distillate water and plated on potato dextrose agar (PDA; Merck, Darmstadt, Germany). Purification of isolates was done by hyphal tip technique. Among the isolated fungi, one isolate that was recovered from Imperator work stone in Hafiz town, Shiraz (Fars province) was identified as Ascotricha funiculosa (Guarro & Calvo) D.W. Li & G.H. Zhao, based on morphological features (Guarro and Calvo 1983) and sequences data. Macroscopic and microscopic features of the fungus are given here. Colonies were slow-growing, attaining a diameter of 17 mm in seven days on PDA (Merck, Darmstadt, Germany), first dull white, then becoming grayish with a white edge (Fig. 1b). The colony on the reverse side of the agar plate was blackish (Fig. 1c). Conidiophores were borne mostly as short vertical branches from individual hyphae, commonly 70-130 × 2.5–4.5 μm, composed of a differentiated supporting hyphae bearing sterile swollen cells hyaline and groups of conidiogenous cells. Stipe was smooth, simple or once branched, septate, hyaline when young, becoming olive-brown at maturity, swollen cells hyalin, sterile, thin-walled, 6-8 × 4-5 μm, rounded above (Fig. 1d-h). Conidiogenous cells were lateral and terminal, sympodial, developing conidia on denticles (Fig. 1g-h). Conidia were smooth, subglobose to ellipsoidal, unicellular, hyaline when young, becoming light brown at maturity, with a minute scar at the base, and 4–6 × 3.5–4.5 μm (x̄ = 5 × 3.5 μm, n = 100) (Fig. 1i). For confirmation of morphological identification, DNA of representative isolate was extracted using a commercial kit (Zagros Bioidea Co., Razi University Incubator, Kermanshah, Iran). PCR was performed using primers ITS1 (CCGTAGGTGAACCTGCGC) and ITS4 (TCCTCCGCTTATTGATATGC) for the internal transcribed spacer region (ITS1-5.8S-ITS2) of the nuclear ribosomal DNA (rDNA) (White et al. 1990), and Bt2a (GGTAACCAAATCGGTGCTGC TTTC) and Bt2b (ACCCTCAGTGTAGTGACCC TTGGC) for a part of the β-tubulin gene (Glass & Donaldson 1995). The PCR product was submitted for sequencing to a capillary sequencing machine (Pishgam Biotech Co., Tehran, Iran). The sequence generated in this study was deposited in GenBank under accession number OK324153 (ITS) and OK337389 (β-tubulin gene). BLAST analysis revealed a high nucleotide identity (99% for ITS and 98.7% for β-tubulin gene) with the ITS region and β-tubulin gene of Ascotricha funiculosa isolate CBS 323.86 (KU684134 and KU683762) that was recently reported from North American (Cheng et al. 2015). Two datasets, including individual aligned sequences of ITS, and the combined ITS and β-tubulin datasets (ITS- β-tubulin), were used to phylogenetic analysis of Ascotricha. Phylogenetic analyses were performed using maximum likelihood (ML) method in the MEGA Ver. X program (Kumar et al. 2018). Phylogenetic analyses based on ITS (Fig. 2), and combined ITS and β-tubulin gene sequences (Fig. 3) of our isolates and 22 selected isolates of Ascotricha (Table 1) showed that our isolates are closely related to A. funiculosa (Figs. 3, 4). The isolates formed a well-supported clade with the reliable reference strains of A. funiculosa (Figs. 2, 3), placed separately from the other species of Ascotricha. The result of the phylogenetic analysis was in accordance with the molecular identification based on DNA sequences in BLAST search, thus resolving the morphological identification. In Iran, Ascotricha chartarum has been reported from Abbas abad travertine stone (Jamali 2021). Information about of A. funiculosa is rare and this species previously has been reported from Spain. A. funiculosa differs from other species in the morphology of its conidiogenous cells (Guarro & Calvo 1983) and in lacking a sexual stage. In this study also, sexual stage was not seen in culture media. Ascotricha funiculosa is new to the Iranian funga, and is reported for the first time from building stone in the world. A subculture of this fungus is preserved at the Iranian Fungal Culture Collection of the Iranian Research Institute of Plant Protection (Tehran, Iran) under accession number IRAN 4558C. The genus Ascotricha (Ascomycetes, Xylariaceae) was erected by Berkeley in 1838 to accommodate the single species A. chartarum (Hawksworth 1971). So far, 29, and 30 Ascotricha species are recorded in the MycoBank and Index Fungorum, respectively. Many researchers have reported Ascotricha species in the China, Germany, India, Italy, New Zealand, North America, Portugal, and Spain, (Stchigel & Guarro 1998; Udagawa & Uchiyama 1999; Li & Yang 2004; U’Ren et al. 2016; Vu et al. 2019) but no such studies have been carried out in Iran. |